Review



cdna copy of sequence verified sept9 transcript variant 1  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    OriGene cdna copy of sequence verified sept9 transcript variant 1
    Cdna Copy Of Sequence Verified Sept9 Transcript Variant 1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sequence+verified+sept9+transcript+variant+1/cdna+copy+of+sequence+verified+sept9+transcript+variant+1/pmc03484102__supp_E12___06___0486_CombinedSupMats-45-101-114
    Average 90 stars, based on 1 article reviews
    cdna copy of sequence verified sept9 transcript variant 1 - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Mammalian SEPT9 isoforms direct microtubule-dependent arrangements of septin core heteromers
    Article Snippet: Even so, it is still notable that deletion of septin genes in unicellular fungi like Saccharomyces cerevisiae and Schizosaccharomyces pombe results in different phenotypes and that the phenotype is subtle in the latter fungi (Oh and Bi, 2011). .. Primer pairs used for RT-PCR analysis SEPT9 transcript variant 1 to 7 Splice variant Forward Reverse bp* SEPT9_v1: 5’- GCCCAGGATTAGCGCCCTGG 5’- GACGCCTTGGGGGAGCGTTG 347 SEPT9_v2: 5’- GCTGCCCACCAGCCATCATGT 5’- GCCCTCTTGAGCCCGAACCG 400 SEPT9_v3: 5’- TGGTCTGCCGGACTCCTCGG 5’- GGGTGTCTCGACCTCCTCGACC 398 SEPT9_v4: 5’- GGAGGCTGCTCCAGTGTGCAT 5’- CGTAGCCGAAGTCCACCGGG 395 SEPT9_v5: 5’- TCTGCCCTGAGTGTGTGGGTCC 5’- GCGGGCCGAGGGTTCTGAGT 395 SEPT9_v6: 5’- GGAGAGGGGGCTGGGGCATAA 5’- ACGCCTTGGGGGAGCGTTG 390 SEPT9_v7: 5’- TCTGGCAGATCCCAGCGTCCA 5’- TCATGGCCTTCCGGCGCATCT 382 * Length of PCR product Construction of pMEP4 derivates directing regulatable expression of SEPT9 transcript variant 1, 5/6 and 7 (As indicated in Figure 1A, the cognate protein isoforms are termed SEPT9 isoform a, e and f according to NCBI Refseq) A cDNA copy of sequence verified SEPT9 transcript variant 1 (accession NM_001113491.1, purchased from Origen, Cat. No. SC318940) was cloned as a NotI fragment into the corresponding site of the pMEP4 vector (termed pMEP-SEPT9(a)). ..

    Variant Assay:

    Article Title: Mammalian SEPT9 isoforms direct microtubule-dependent arrangements of septin core heteromers
    Article Snippet: Even so, it is still notable that deletion of septin genes in unicellular fungi like Saccharomyces cerevisiae and Schizosaccharomyces pombe results in different phenotypes and that the phenotype is subtle in the latter fungi (Oh and Bi, 2011). .. Primer pairs used for RT-PCR analysis SEPT9 transcript variant 1 to 7 Splice variant Forward Reverse bp* SEPT9_v1: 5’- GCCCAGGATTAGCGCCCTGG 5’- GACGCCTTGGGGGAGCGTTG 347 SEPT9_v2: 5’- GCTGCCCACCAGCCATCATGT 5’- GCCCTCTTGAGCCCGAACCG 400 SEPT9_v3: 5’- TGGTCTGCCGGACTCCTCGG 5’- GGGTGTCTCGACCTCCTCGACC 398 SEPT9_v4: 5’- GGAGGCTGCTCCAGTGTGCAT 5’- CGTAGCCGAAGTCCACCGGG 395 SEPT9_v5: 5’- TCTGCCCTGAGTGTGTGGGTCC 5’- GCGGGCCGAGGGTTCTGAGT 395 SEPT9_v6: 5’- GGAGAGGGGGCTGGGGCATAA 5’- ACGCCTTGGGGGAGCGTTG 390 SEPT9_v7: 5’- TCTGGCAGATCCCAGCGTCCA 5’- TCATGGCCTTCCGGCGCATCT 382 * Length of PCR product Construction of pMEP4 derivates directing regulatable expression of SEPT9 transcript variant 1, 5/6 and 7 (As indicated in Figure 1A, the cognate protein isoforms are termed SEPT9 isoform a, e and f according to NCBI Refseq) A cDNA copy of sequence verified SEPT9 transcript variant 1 (accession NM_001113491.1, purchased from Origen, Cat. No. SC318940) was cloned as a NotI fragment into the corresponding site of the pMEP4 vector (termed pMEP-SEPT9(a)). ..

    Polymerase Chain Reaction:

    Article Title: Mammalian SEPT9 isoforms direct microtubule-dependent arrangements of septin core heteromers
    Article Snippet: Even so, it is still notable that deletion of septin genes in unicellular fungi like Saccharomyces cerevisiae and Schizosaccharomyces pombe results in different phenotypes and that the phenotype is subtle in the latter fungi (Oh and Bi, 2011). .. Primer pairs used for RT-PCR analysis SEPT9 transcript variant 1 to 7 Splice variant Forward Reverse bp* SEPT9_v1: 5’- GCCCAGGATTAGCGCCCTGG 5’- GACGCCTTGGGGGAGCGTTG 347 SEPT9_v2: 5’- GCTGCCCACCAGCCATCATGT 5’- GCCCTCTTGAGCCCGAACCG 400 SEPT9_v3: 5’- TGGTCTGCCGGACTCCTCGG 5’- GGGTGTCTCGACCTCCTCGACC 398 SEPT9_v4: 5’- GGAGGCTGCTCCAGTGTGCAT 5’- CGTAGCCGAAGTCCACCGGG 395 SEPT9_v5: 5’- TCTGCCCTGAGTGTGTGGGTCC 5’- GCGGGCCGAGGGTTCTGAGT 395 SEPT9_v6: 5’- GGAGAGGGGGCTGGGGCATAA 5’- ACGCCTTGGGGGAGCGTTG 390 SEPT9_v7: 5’- TCTGGCAGATCCCAGCGTCCA 5’- TCATGGCCTTCCGGCGCATCT 382 * Length of PCR product Construction of pMEP4 derivates directing regulatable expression of SEPT9 transcript variant 1, 5/6 and 7 (As indicated in Figure 1A, the cognate protein isoforms are termed SEPT9 isoform a, e and f according to NCBI Refseq) A cDNA copy of sequence verified SEPT9 transcript variant 1 (accession NM_001113491.1, purchased from Origen, Cat. No. SC318940) was cloned as a NotI fragment into the corresponding site of the pMEP4 vector (termed pMEP-SEPT9(a)). ..

    Expressing:

    Article Title: Mammalian SEPT9 isoforms direct microtubule-dependent arrangements of septin core heteromers
    Article Snippet: Even so, it is still notable that deletion of septin genes in unicellular fungi like Saccharomyces cerevisiae and Schizosaccharomyces pombe results in different phenotypes and that the phenotype is subtle in the latter fungi (Oh and Bi, 2011). .. Primer pairs used for RT-PCR analysis SEPT9 transcript variant 1 to 7 Splice variant Forward Reverse bp* SEPT9_v1: 5’- GCCCAGGATTAGCGCCCTGG 5’- GACGCCTTGGGGGAGCGTTG 347 SEPT9_v2: 5’- GCTGCCCACCAGCCATCATGT 5’- GCCCTCTTGAGCCCGAACCG 400 SEPT9_v3: 5’- TGGTCTGCCGGACTCCTCGG 5’- GGGTGTCTCGACCTCCTCGACC 398 SEPT9_v4: 5’- GGAGGCTGCTCCAGTGTGCAT 5’- CGTAGCCGAAGTCCACCGGG 395 SEPT9_v5: 5’- TCTGCCCTGAGTGTGTGGGTCC 5’- GCGGGCCGAGGGTTCTGAGT 395 SEPT9_v6: 5’- GGAGAGGGGGCTGGGGCATAA 5’- ACGCCTTGGGGGAGCGTTG 390 SEPT9_v7: 5’- TCTGGCAGATCCCAGCGTCCA 5’- TCATGGCCTTCCGGCGCATCT 382 * Length of PCR product Construction of pMEP4 derivates directing regulatable expression of SEPT9 transcript variant 1, 5/6 and 7 (As indicated in Figure 1A, the cognate protein isoforms are termed SEPT9 isoform a, e and f according to NCBI Refseq) A cDNA copy of sequence verified SEPT9 transcript variant 1 (accession NM_001113491.1, purchased from Origen, Cat. No. SC318940) was cloned as a NotI fragment into the corresponding site of the pMEP4 vector (termed pMEP-SEPT9(a)). ..

    Sequencing:

    Article Title: Mammalian SEPT9 isoforms direct microtubule-dependent arrangements of septin core heteromers
    Article Snippet: Even so, it is still notable that deletion of septin genes in unicellular fungi like Saccharomyces cerevisiae and Schizosaccharomyces pombe results in different phenotypes and that the phenotype is subtle in the latter fungi (Oh and Bi, 2011). .. Primer pairs used for RT-PCR analysis SEPT9 transcript variant 1 to 7 Splice variant Forward Reverse bp* SEPT9_v1: 5’- GCCCAGGATTAGCGCCCTGG 5’- GACGCCTTGGGGGAGCGTTG 347 SEPT9_v2: 5’- GCTGCCCACCAGCCATCATGT 5’- GCCCTCTTGAGCCCGAACCG 400 SEPT9_v3: 5’- TGGTCTGCCGGACTCCTCGG 5’- GGGTGTCTCGACCTCCTCGACC 398 SEPT9_v4: 5’- GGAGGCTGCTCCAGTGTGCAT 5’- CGTAGCCGAAGTCCACCGGG 395 SEPT9_v5: 5’- TCTGCCCTGAGTGTGTGGGTCC 5’- GCGGGCCGAGGGTTCTGAGT 395 SEPT9_v6: 5’- GGAGAGGGGGCTGGGGCATAA 5’- ACGCCTTGGGGGAGCGTTG 390 SEPT9_v7: 5’- TCTGGCAGATCCCAGCGTCCA 5’- TCATGGCCTTCCGGCGCATCT 382 * Length of PCR product Construction of pMEP4 derivates directing regulatable expression of SEPT9 transcript variant 1, 5/6 and 7 (As indicated in Figure 1A, the cognate protein isoforms are termed SEPT9 isoform a, e and f according to NCBI Refseq) A cDNA copy of sequence verified SEPT9 transcript variant 1 (accession NM_001113491.1, purchased from Origen, Cat. No. SC318940) was cloned as a NotI fragment into the corresponding site of the pMEP4 vector (termed pMEP-SEPT9(a)). ..

    Clone Assay:

    Article Title: Mammalian SEPT9 isoforms direct microtubule-dependent arrangements of septin core heteromers
    Article Snippet: Even so, it is still notable that deletion of septin genes in unicellular fungi like Saccharomyces cerevisiae and Schizosaccharomyces pombe results in different phenotypes and that the phenotype is subtle in the latter fungi (Oh and Bi, 2011). .. Primer pairs used for RT-PCR analysis SEPT9 transcript variant 1 to 7 Splice variant Forward Reverse bp* SEPT9_v1: 5’- GCCCAGGATTAGCGCCCTGG 5’- GACGCCTTGGGGGAGCGTTG 347 SEPT9_v2: 5’- GCTGCCCACCAGCCATCATGT 5’- GCCCTCTTGAGCCCGAACCG 400 SEPT9_v3: 5’- TGGTCTGCCGGACTCCTCGG 5’- GGGTGTCTCGACCTCCTCGACC 398 SEPT9_v4: 5’- GGAGGCTGCTCCAGTGTGCAT 5’- CGTAGCCGAAGTCCACCGGG 395 SEPT9_v5: 5’- TCTGCCCTGAGTGTGTGGGTCC 5’- GCGGGCCGAGGGTTCTGAGT 395 SEPT9_v6: 5’- GGAGAGGGGGCTGGGGCATAA 5’- ACGCCTTGGGGGAGCGTTG 390 SEPT9_v7: 5’- TCTGGCAGATCCCAGCGTCCA 5’- TCATGGCCTTCCGGCGCATCT 382 * Length of PCR product Construction of pMEP4 derivates directing regulatable expression of SEPT9 transcript variant 1, 5/6 and 7 (As indicated in Figure 1A, the cognate protein isoforms are termed SEPT9 isoform a, e and f according to NCBI Refseq) A cDNA copy of sequence verified SEPT9 transcript variant 1 (accession NM_001113491.1, purchased from Origen, Cat. No. SC318940) was cloned as a NotI fragment into the corresponding site of the pMEP4 vector (termed pMEP-SEPT9(a)). ..

    Plasmid Preparation:

    Article Title: Mammalian SEPT9 isoforms direct microtubule-dependent arrangements of septin core heteromers
    Article Snippet: Even so, it is still notable that deletion of septin genes in unicellular fungi like Saccharomyces cerevisiae and Schizosaccharomyces pombe results in different phenotypes and that the phenotype is subtle in the latter fungi (Oh and Bi, 2011). .. Primer pairs used for RT-PCR analysis SEPT9 transcript variant 1 to 7 Splice variant Forward Reverse bp* SEPT9_v1: 5’- GCCCAGGATTAGCGCCCTGG 5’- GACGCCTTGGGGGAGCGTTG 347 SEPT9_v2: 5’- GCTGCCCACCAGCCATCATGT 5’- GCCCTCTTGAGCCCGAACCG 400 SEPT9_v3: 5’- TGGTCTGCCGGACTCCTCGG 5’- GGGTGTCTCGACCTCCTCGACC 398 SEPT9_v4: 5’- GGAGGCTGCTCCAGTGTGCAT 5’- CGTAGCCGAAGTCCACCGGG 395 SEPT9_v5: 5’- TCTGCCCTGAGTGTGTGGGTCC 5’- GCGGGCCGAGGGTTCTGAGT 395 SEPT9_v6: 5’- GGAGAGGGGGCTGGGGCATAA 5’- ACGCCTTGGGGGAGCGTTG 390 SEPT9_v7: 5’- TCTGGCAGATCCCAGCGTCCA 5’- TCATGGCCTTCCGGCGCATCT 382 * Length of PCR product Construction of pMEP4 derivates directing regulatable expression of SEPT9 transcript variant 1, 5/6 and 7 (As indicated in Figure 1A, the cognate protein isoforms are termed SEPT9 isoform a, e and f according to NCBI Refseq) A cDNA copy of sequence verified SEPT9 transcript variant 1 (accession NM_001113491.1, purchased from Origen, Cat. No. SC318940) was cloned as a NotI fragment into the corresponding site of the pMEP4 vector (termed pMEP-SEPT9(a)). ..



    Similar Products

    90
    OriGene cdna copy of sequence verified sept9 transcript variant 1
    Cdna Copy Of Sequence Verified Sept9 Transcript Variant 1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sequence+verified+sept9+transcript+variant+1/cdna+copy+of+sequence+verified+sept9+transcript+variant+1/pmc03484102__supp_E12___06___0486_CombinedSupMats-45-101-114
    Average 90 stars, based on 1 article reviews
    cdna copy of sequence verified sept9 transcript variant 1 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    OriGene sequence verified sept9 transcript variant 1
    Sequence Verified Sept9 Transcript Variant 1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sequence+verified+sept9+transcript+variant+1/Sept9+(NM_001113497)+Rat+Untagged+Clone/pmc03484102__supp_E12___06___0486_CombinedSupMats-45-104-114
    Average 90 stars, based on 1 article reviews
    sequence verified sept9 transcript variant 1 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results